Sequence 253 from patent US 6797808 (N00590) Nucleic Acid Card

General Information
Name Sequence 253 from patent US 6797808
Organism Unknown
Organism Diet
Organism Clade
Organism Region
Notes

Sequence
tctgaaggcaggaatgctgaagccatcgacaacgccttag
accagagggatccaaagcgacaggagccggggtgctgtag
gcatcctgcctgtgggaagaacagatgtggaagacgctga
tgctccaggaccctctgaaccacgacg
t
Sequence translation SEGRNAEAIDNALDQRDPKRQEPGCCRHPACGKNRCGRR-
CSRTL-TTT

References
Watkins,M., Olivera,B.M., Hillyard,D.R., McIntosh,J.M. and Jones,R.M. (2002) Alpha-conotoxin peptides JP 2002534996-A 11 22-OCT-2002

Internal links
Proteins Encoded P1.9 precursor

External links
Ncbi
GenBank AR584860

Tools