Conus litteratus clone 07H06 A superfamily conotoxin Lt1c precursor, mRNA, complete cds (N00995) Nucleic Acid Card

General Information
Name Conus litteratus clone 07H06 A superfamily conotoxin Lt1c precursor, mRNA, complete cds
Organism Conus litteratus
Organism Diet vermivorous
Organism Clade
Organism Region Indo-Pacific
Notes

Sequence
gagagaaaataacc
atgggcatgcggatgatgttcaccat
gtttctgttggttgttttgacaaccactgtggtttccttc
aatttagatcgtgaatccaatcacgagaatcgcagaacat
ctaaccagattacgcggggcatgtgggatgaatgctgtga
cgatcctccatgtcggcaaaataatatggagcattgtccc
gcaagt
tgaggatgttgcagccgcccttgacttcagatgg
ttgcgatgccgccatccctctgagtgaccatcacctctgt
ctcttttatcctactgcaactaaagaactctttagcgaat
tccgtcctcagctgtgtgtcggattctttttttttttttt
ttctttttttttcttcttgttcctttaacaagcgcgttcc
acgaggaatgtcgnggtgtgcttaaatgtttcanaccttt
ataagcctcctttttctccctgtggctggtggattgtaat
gtcgcttaattcgtctcaacattgttaaattcngcttcga
tttgagtttcgaattatagcaatacttggaaatgacatat
catcctcggaaaaggccaattgatgtcaattttagcggga
aagagagagatagaaaaaaaaaaaaaaaaggaagttacgg
aanccttggaaaacanacnaagacaaaaangnaaanaaac
ttttctnggncnnanttgtttgcttncntatncccttcaa
aaaaaaaaagaaagaaagnaaattaacagtcnggntca
Sequence translation MGMRMMFTMFLLVVLTTTVVSFNLDRESNHENRRTSNQIT
RGMWDECCDDPPCRQNNMEHCPAS

References
Pi,C., Liu,J., Peng,C., Liu,Y., Jiang,X., Zhao,Y., Tang,S., Wang,L., Dong,M., Chen,S. and Xu,A. (2006) Diversity and evolution of conotoxins based on gene expression profiling of Conus litteratus Genomics 88:809-819

Internal links
Proteins Encoded Lt1C precursor

External links
Ncbi
GenBank DQ345366

Tools