Conus striatus omega conotoxin SVIA mutant 2 precursor, mRNA, complete cds (N00001) Nucleic Acid Card

General Information
Name Conus striatus omega conotoxin SVIA mutant 2 precursor, mRNA, complete cds
Organism Conus striatus (Striated cone)
Organism Diet piscivorous
Organism Clade I
Organism Region Indo-Pacific
Notes

Sequence
atgaaactgacgtgcatggtgatcgtcgccgtgctgctcc
tgacggcctgtcaactcatcacagctgaggactctagagg
tacgcagaagcatcgtaccctgcggtcgaccgccagacgc
tccaagtccgagttgactacgagatgcagacctagtggat
ccccctgtggtgttactagtatatgctgtggtaggtgctc
taggggtaaatgtacg
tagctcatcgggcgtctgatcttc
ccccttctgtgctctatccttctctgcctgagtcctcctt
aactgagagtggtcgtgaaccactcatcgcctactcctct
ggaggcttcagaggggctacactaaaataaaa
Sequence translation MKLTCMVIVAVLLLTACQLITAEDSRGTQKHRTLRSTARR
SKSELTTRCRPSGSPCGVTSICCGRCSRGKCT

References
Lu,B.S., Yu,F., Zhao,D., Huang,P.T. and Huang,C.F. (1999) Conopeptides from Conus striatus and Conus textile by cDNA cloning Peptides 20:1139-1144

Internal links
Proteins Encoded Conotoxin-15 precursor

External links
Ncbi
GenBank AF146361

Tools