Conus leopardus alpha conotoxin Lp1.7 mRNA, partial cds (N01029) Nucleic Acid Card

General Information
Name Conus leopardus alpha conotoxin Lp1.7 mRNA, partial cds
Organism Conus leopardus
Organism Diet vermivorous
Organism Clade
Organism Region Indo-Pacific
Notes

Sequence
atgggcatgcggatgatgttcaccatgtttctgttggttg
ttttgacaactactgtggtttccttcaattcagatcgtga
atccaatcacgagaatcgcagaacatctaaccagattacg
cggggcgtttgggatgaatgctgtaaagatcctcaatgtc
ggcaaaatcatatgcagcattgtcccgcacgt
tgaggatg
ttgcagccgccctcgacttcagatggttgcgatgccacca
tccctctgagtgaccatcacctctgtctcttttatcctac
tgcaactaaagaactctttagcgaactccgtcctcagctg
tgtgtccaattccttttttttttttcttcttcttcttctt
cttcttcttcttcttgttcctttaacaagcgcgttccagg
aggaatgtcgtggtgtgcttaaatgtttcagacatttata
accctccttttttctccctgtggctggtggattgtgatgt
cgcttaattcgtctcaacattgttaaattctgcttcgatt
tgagattccaattatagcaatacttggatatgacatatca
tcctcggaaaaggccaattgatgtcaattttagcgggaaa
gagagagatagaaaaaaaaaaaggaagttacggaaccttg
aaaaacagacaaagacaaaacaggaaaacaaacttttctc
ggtcgtagttgtttgctttcttgtaccccttaaaaagaaa
agaaagaaaattatcagtctggatcagctatcttaatctg
ttctcatccactttatatagggataatatttctatttgat
tgcatttattcattttaatctgaccattgctgaagattct
ttgcctatacacatgacctgacaataaacattttttggag
gtgcaaaaaaaaaaaaaaaaaa
Sequence translation MGMRMMFTMFLLVVLTTTVVSFNSDRESNHENRRTSNQIT
RGVWDECCKDPQCRQNHMQHCPAR

References
Yuan,D.D., Han,Y.H., Wang,C.G. and Chi,C.W. (2007) From the identification of gene organization of alpha conotoxins to the cloning of novel toxins Toxicon 49:1135-1149

Internal links
Proteins Encoded Lp1.8 precursor

External links
Ncbi
GenBank DQ311062

Tools