Conus ebraeus O-superfamily conotoxin (E1) gene, E1l allele,partial cds. (N01617) Nucleic Acid Card

General Information

Name	Conus ebraeus O-superfamily conotoxin (E1) gene, E1l allele,partial cds.
Organism	Conus ebraeus
Organism Diet	vermivorous
Organism Clade	XI
Organism Region	Indo-Pacific,Eastern Pacific
Notes

Sequence

c acacgttccggcggagcctgtaatagtcataatcaatgc tgcgacgatttttgcagtacggcgaccagcacatgtgtt t aaact
Sequence translation	TRSGGACNSHNQCCDDFCSTATSTCV

References

Duda,T.F. Jr., Chang,D., Lewis,B.D. and Lee,T. (2009) Geographic variation in venom allelic composition and diets of the widespread predatory marine gastropod Conus ebraeus. PLoS ONE 4

Internal links

Proteins Encoded

Eb6.15 (Partial)

External links

Ncbi
GenBank	FJ834436

Tools

Please cite:
Kaas Q, Yu R, Jin AH, Dutertre S and Craik DJ. ConoServer: updated content, knowledge, and discovery tools in the conopeptide database. Nucleic Acids Research (2012) 40(Database issue):D325-30
Kaas Q, Westermann JC, Halai R, Wang CK and Craik DJ. ConoServer, a database for conopeptide sequences and structures. Bioinformatics (2008) 24(3):445-6

ConoServer is managed at the Institute of Molecular Bioscience IMB, Brisbane, Australia.

The database and computational tools found on this website may be used for academic research only, provided that it is referred to ConoServer, the database of conotoxins (http://www.conoserver.org) and the above reference is cited. For any other use please contact David Craik (d.craik@imb.uq.edu.au).

Contacts:
David Craik
Quentin Kaas

Last updated: Tuesday 28 March 2023