Conus tulipa rho conotoxin A-superfamily protein mRNA, partial cds. (N01840) Nucleic Acid Card

General Information
Name Conus tulipa rho conotoxin A-superfamily protein mRNA, partial cds.
Organism Conus tulipa (tulip cone)
Organism Diet piscivorous
Organism Clade II
Organism Region Indo-Pacific
Notes

Sequence
gaattcgcccttatgttcaccgtgtttctgttggttgtcc
tggcaaccaccggtgtttccttcactttagatcgtgcatc
tgatggcgggaatgccgtagcaaaaaagtctgacgtgacc
gctcggttcaactggcgctgctgtctcattcctgcctgtc
gtaggaatcacaaaaagttttgtggc
Sequence translation EFALMFTVFLLVVLATTGVSFTLDRASDGGNAVAKKSDVT
ARFNWRCCLIPACRRNHKKFCG

References

Internal links
Proteins Encoded rho conotoxin A-superfamily protein [Conus tulipa].

External links
Ncbi
GenBank GQ981400

Tools