Conus pennaceus clone PnMKLT1-01112 conotoxin scaffold VI/VII precursor, mRNA, partial cds (N00209) Nucleic Acid Card

General Information
Name Conus pennaceus clone PnMKLT1-01112 conotoxin scaffold VI/VII precursor, mRNA, partial cds
Organism Conus pennaceus
Organism Diet molluscivorous
Organism Clade V
Organism Region Indo-Pacific
Notes

Sequence
g
ccttgctgcagtggctggtgctttttcgcctgcgcc
taa
aactgccgtgatgtcttctactcccgtctgtgctacttgg
cttgatctttgattggcgcgtgcccttcactggtaatgaa
ccactctgatccgactctctgggggcctcgggggttcaac
atccaaataaagcgacatcacaatcaa
Sequence translation PCCSGWCFFACA

References
Conticello,S.G., Gilad,Y., Avidan,N., Ben-Asher,E., Levy,Z. and Fainzilber,M. (2001) Mechanisms for evolving hypervariability: the case of conopeptides Mol. Biol. Evol. 18:120-131

Internal links
Proteins Encoded PnMKLT1-01112 (partial)

External links
Ncbi
GenBank AF215109

Tools