Conus coronatus A superfamily conotoxin Co1.1 precursor, mRNA, complete cds. (N02397) Nucleic Acid Card

General Information

Name	Conus coronatus A superfamily conotoxin Co1.1 precursor, mRNA, complete cds.
Organism	Conus coronatus
Organism Diet	vermivorous
Organism Clade	XI
Organism Region	Indo-Pacific
Notes

Sequence

atgggcatgcggatgatgtccaccgtgtttctgttggttg tcctggcaaccgctgtcgtttccttcactttagatcgtgc atcagatggcggggatgccgcagccaaagcgtttgacctg atggctctgaccgccagactagattgctgtgacattcatg cctgttggtcggcgcatccagaactttgtggaggaagacg ctga
Sequence translation	MGMRMMSTVFLLVVLATAVVSFTLDRASDGGDAAAKAFDL MALTARLDCCDIHACWSAHPELCGGRR-

References

Wu,Y., Wang,L., Zhou,M., You,Y., Zhu,X., Qiang,Y., Qin,M., Luo,S., Ren,Z. and Xu,A. (2013) Molecular evolution and diversity of Conus peptide toxins, as revealed by gene structure and intron sequence analyses. PLoS ONE 8

Internal links

Proteins Encoded

Co1.1 precursor

External links

Ncbi
GenBank	JX293410

Tools

Please cite:
Kaas Q, Yu R, Jin AH, Dutertre S and Craik DJ. ConoServer: updated content, knowledge, and discovery tools in the conopeptide database. Nucleic Acids Research (2012) 40(Database issue):D325-30
Kaas Q, Westermann JC, Halai R, Wang CK and Craik DJ. ConoServer, a database for conopeptide sequences and structures. Bioinformatics (2008) 24(3):445-6

ConoServer is managed at the Institute of Molecular Bioscience IMB, Brisbane, Australia.

The database and computational tools found on this website may be used for academic research only, provided that it is referred to ConoServer, the database of conotoxins (http://www.conoserver.org) and the above reference is cited. For any other use please contact David Craik (d.craik@imb.uq.edu.au).

Contacts:
David Craik
Quentin Kaas

Last updated: Monday 27 March 2023