Conus textile A superfamily conotoxin Tx1.3 precursor, mRNA, complete cds. (N02412) Nucleic Acid Card

General Information
Name Conus textile A superfamily conotoxin Tx1.3 precursor, mRNA, complete cds.
Organism Conus textile (Cloth-of-gold cone)
Organism Diet molluscivorous
Organism Clade V
Organism Region Indo-Pacific
Notes

Sequence
atgggcatgcggatgatgttcactgtgtttctgttggttg
tcttggcaaccgccgtcgtttccttcacttcagatcgtgc
atctgatgacaggaaagccgctgcgtctgacctgatcact
ctgaccatcaagggatgctgttcgcgtcctccctgtatcg
cgaatgatccagacttgtgtggttga
Sequence translation MGMRMMFTVFLLVVLATAVVSFTSDRASDDRKAAASDLIT
LTIKGCCSRPPCIANDPDLCG-

References

Internal links
Proteins Encoded Tx1.3 precursor

External links
Ncbi
GenBank JX293425

Tools