Conus quercinus A superfamily conotoxin Qc1.13 precursor, mRNA, complete cds. (N02435) Nucleic Acid Card

General Information
Name Conus quercinus A superfamily conotoxin Qc1.13 precursor, mRNA, complete cds.
Organism Conus quercinus
Organism Diet vermivorous
Organism Clade VII
Organism Region Indo-Pacific
Notes

Sequence
atgggcatgcggatgatgttcaccatgtttctgttggttg
tcttggcaatcacggtggtttccttcacctcagatcatgc
atctgatggcaggaataccgcagctaacgacaaagcgtct
aacctgatggctcttagggacgaatgctgtcccaatcctc
cgtgtaaggcgagtaatccagatttgtgtgactggagaag
ctga
Sequence translation MGMRMMFTMFLLVVLAITVVSFTSDHASDGRNTAANDKAS
NLMALRDECCPNPPCKASNPDLCDWRS-

References

Internal links
Proteins Encoded Qc1.8 precursor

External links
Ncbi
GenBank JX293450

Tools