Conus imperialis alpha-conotoxin ImI precursor, gene, exon 2 and partial cds (N00279) Nucleic Acid Card

General Information
Name Conus imperialis alpha-conotoxin ImI precursor, gene, exon 2 and partial cds
Organism Conus imperialis
Organism Diet vermivorous
Organism Clade XVII
Organism Region Indo-Pacific
Notes

Sequence
atcgtcaggagaggatgctgttccgaccctcgctgtgcct
ggagatgtggt
tga
Sequence translation IVRRGCCSDPRCAWRCG

References
Ellison,M.A., McIntosh,J.M. and Olivera,B.M. (2003) alpha-Conotoxins ImI and ImII: similar alpha 7 nicotinic receptor antagonists act at different sites J. Biol. Chem. 278:757-764

Internal links
Proteins Encoded ImI precursor

External links
Ncbi
GenBank AY159318

Tools