Con-Ins K1 precursor (N02947) Nucleic Acid Card

General Information

Name	Con-Ins K1 precursor
Organism	Conus kinoshitai
Organism Diet	piscivorous
Organism Clade
Organism Region	Indo-Pacific
Notes

Sequence

atgacgacatcgtcctactttctgctggtggccctaggcc ttctgctgtacgtgtgtcaatcttcctttggcagcccaca tacc agcgactctggtaccactcttgttcgacgtcgctta tgtggatcagagctagtgacgtatctcggggaactgtgtc ttggcaac aggaagcgacggggctttccctccatgctgaa ggcacgggccaagaggaatgaagcatttcttctgcagaga gatggccgg ggtatagtcgaagactgttgttacaacgact gcactgatgaaaaattgaaggagtattgtcatacattgca g ggttaa
Sequence translation	SDSGTTLVRRRLCGSELVTYLGELCLGN GIVEDCCYNDCTDEKLKEYCHTLQ

References

Ahorukomeye, P., Disotuar, M.M., Gajewiak, J., Karanth, S., Watkins, M., Robinson, S.D., Salcedo, P.F., Smith, N.A., Smith, B.J., Schlegel, A. and Forbes, B.E. (2019) Fish-hunting cone snail venoms are a rich source of minimized ligands of the vertebrate insulin receptor eLife 8

Internal links

Proteins Encoded

Con-Ins K1 B Chain
Con-Ins K1 A Chain

External links

Ncbi
GenBank	MH879033

Tools

Please cite:
Kaas Q, Yu R, Jin AH, Dutertre S and Craik DJ. ConoServer: updated content, knowledge, and discovery tools in the conopeptide database. Nucleic Acids Research (2012) 40(Database issue):D325-30
Kaas Q, Westermann JC, Halai R, Wang CK and Craik DJ. ConoServer, a database for conopeptide sequences and structures. Bioinformatics (2008) 24(3):445-6

ConoServer is managed at the Institute of Molecular Bioscience IMB, Brisbane, Australia.

The database and computational tools found on this website may be used for academic research only, provided that it is referred to ConoServer, the database of conotoxins (http://www.conoserver.org) and the above reference is cited. For any other use please contact David Craik (d.craik@imb.uq.edu.au).

Contacts:
David Craik
Quentin Kaas

Last updated: Tuesday 28 March 2023