Alpha-conotoxin peptides (N00309) Nucleic Acid Card

General Information
Name Alpha-conotoxin peptides
Organism Conus aulicus
Organism Diet molluscivorous
Organism Clade V
Organism Region Indo-Pacific
Notes

Sequence
atgttcaccgtgtttctgttggttgtcttggcaaccaccg
tcgtttccttcacttcagatcgtgcatctgatggcaggaa
ggacgcagcgtctggcctgatcgctctgaccatcaaggga
tgctgttcttatcctccctgtttcgcgactaattcagact
attgtggt
tgacgacgctgatgctccaggaccctctgaac
cacgacgt
Sequence translation MFTVFLLVVLATTVVSFTSDRASDGRKDAASGLIALTIKG
CCSYPPCFATNSDYCG

References
Watkins,M., Olivera,B.M., Hillyard,D.R., Mcintosh,M.J. and Jones,R.M. (2002) Alpha-conotoxin peptides JP 2002534996-A 11 22-OCT-2002

Internal links
Proteins Encoded AuIA precursor

External links
Ncbi
GenBank BD261396

Tools