AuIB precursor DNA (N00310) Nucleic Acid Card

General Information
Name AuIB precursor DNA
Organism Conus aulicus
Organism Diet molluscivorous
Organism Clade V
Organism Region Indo-Pacific
Notes

Sequence
atgttcaccgtgtttctgttggtcgtcttggcaaccaccg
tcgtttccttcacttcagatcgtgcatctgatggcaggaa
ggacgcagcgtctggcctgattgctctgaccatgaaggga
tgctgttcttatcctccctgtttcgcgactaatccagact
gtggtcgacgacgc
tgatgctccaggaccctctgaaccac
gacgt
Sequence translation MFTVFLLVVLATTVVSFTSDRASDGRKDAASGLIALTMKG
CCSYPPCFATNPDCGRRR

References
Watkins,M., Olivera,B.M., Hillyard,D.R., Mcintosh,M.J. and Jones,R.M. (2002) Alpha-conotoxin peptides JP 2002534996-A 11 22-OCT-2002

Internal links
Proteins Encoded AuIB precursor

External links
Ncbi
GenBank BD261397

Tools