Alpha-conotoxin peptides (N00345) Nucleic Acid Card

General Information
Name Alpha-conotoxin peptides
Organism Unknown
Organism Diet
Organism Clade
Organism Region
Notes

Sequence
atgttcaccgtgtttctgttggttgtcttggcaaccaccg
tcgtttccttcacttcagatggtgcatctgatgacaggaa
agccgctgcgtctgacctgatcactctgaccatcaaggga
tgctgttctcgtcctccctgtatcgcgaataatccagact
tgtgtggtcgacgacgc
tgatgctccaggaccctctgaac
cacgacgt
Sequence translation MFTVFLLVVLATTVVSFTSDGASDDRKAAASDLITLTIKG
CCSRPPCIANNPDLCGRRR

References
Watkins,M., Olivera,B.M., Hillyard,D.R., Mcintosh,M.J. and Jones,R.M. (2002) Alpha-conotoxin peptides JP 2002534996-A 11 22-OCT-2002

Internal links
Proteins Encoded TxIA precursor

External links
Ncbi
GenBank BD261432

Tools