Conus marmoreus alpha conotoxin Mr1.1 mRNA, complete cds (N00491) Nucleic Acid Card

General Information
Name Conus marmoreus alpha conotoxin Mr1.1 mRNA, complete cds
Organism Conus marmoreus
Organism Diet molluscivorous
Organism Clade VI
Organism Region Indo-Pacific
Notes

Sequence
atgggcatgcggatgatgttcaccgtgtttctgttggttg
tcttggcaaccactgtcgtttccttcacttcagatcgtgc
atctgatggcaggaaagccgcagccaaggacaaagcgtct
gacctggtcgctctgaccgtcaagggatgctgttctcatc
ctgcctgtagcgtgaataatccagacatttgtggt
tgaag
acgctgatgctccaggaccctctgaaccacgac
Sequence translation MGMRMMFTVFLLVVLATTVVSFTSDRASDGRKAAAKDKAS
DLVALTVKGCCSHPACSVNNPDICG

References

Internal links
Proteins Encoded Mr1.1 precursor

External links
Ncbi
GenBank AY580325

Tools