Conus striatus omega conotoxin SO3 precursor (SO3) mRNA, complete cds (N00506) Nucleic Acid Card

General Information
Name Conus striatus omega conotoxin SO3 precursor (SO3) mRNA, complete cds
Organism Conus striatus (Striated cone)
Organism Diet piscivorous
Organism Clade I
Organism Region Indo-Pacific
Notes

Sequence
atgaaactgacgtgtatggtgatcgtcgccgtgctgctcc
tgacggcctgtcaactcatcacagctgatgactccagagg
tacgcagaagcatcgtaccctgcggtcgaagaccaaactc
tccatgtcgactcgctgcaaggctgcaggaaaaccatgca
gtaggattgcgtataactgctgcaccggttcttgcagatc
aggtaaatgtggc
tgatccagcgcctgatcttcccccttc
tgc
Sequence translation MKLTCMVIVAVLLLTACQLITADDSRGTQKHRTLRSKTKL
SMSTRCKAAGKPCSRIAYNCCTGSCRSGKCG

References
Lu,B.S., Yu,F., Zhao,D., Huang,P.T. and Huang,C.F. (1999) Conopeptides from Conus striatus and Conus textile by cDNA cloning Peptides 20:1139-1144

Internal links
Proteins Encoded SO3 precursor

External links
Ncbi
GenBank AF146348

Tools