Sequence 118 from patent US 6797808 (N00562) Nucleic Acid Card

General Information
Name Sequence 118 from patent US 6797808
Organism Unknown
Organism Diet
Organism Clade
Organism Region
Notes

Sequence
atgttcaccgtgtttctgttggttgtcttggcaaccactg
tcgtttccttcccttcagatcgtgaatctgatggcgcgaa
tgacgaagcccgcaccgacgagcctgaggagcacggaccg
gacaggaatggatgctgtaggaatcctgcctgtgagagcc
acagatgtggt
tgacgacgctgatgctccaggaccctctg
aaccacgacg
Sequence translation MFTVFLLVVLATTVVSFPSDRESDGANDEARTDEPEEHGP
DRNGCCRNPACESHRCG

References
Watkins,M., Olivera,B.M., Hillyard,D.R., McIntosh,J.M. and Jones,R.M. (2002) Alpha-conotoxin peptides JP 2002534996-A 11 22-OCT-2002

Internal links
Proteins Encoded Sm1.2 precursor

External links
Ncbi
GenBank AR584832

Tools