Conus pergrandis PeIA gene, partial cds (N00940) Nucleic Acid Card

General Information

Name	Conus pergrandis PeIA gene, partial cds
Organism	Conus pergrandis
Organism Diet
Organism Clade
Organism Region	Indo-Pacific
Notes

Sequence

tgtgtgtgtgtggttctgggtccag catttgatggcagga atgccgcagccaacgacaaagcgtccgacctggtcgctct gaccgtcaggggatgctgttcccatcctgcgtgtagcgtg aatcatccagaactttgtggttga agacgctgatgctcca ggaccctctgaaccacgacgt
Sequence translation	HLMAGMPQPTTKRPTWSL-PSGDAVPILRVA-IIQNFVV?

References

McIntosh,J.M., Plazas,P.V., Watkins,M., Gomez-Casati,M.E., Olivera,B.M. and Elgoyhen,A.B. (2005) A novel alpha-conotoxin, PeIA, cloned from Conus pergrandis, discriminates between rat alpha9alpha10 and alpha7 nicotinic cholinergic receptors J. Biol. Chem. 280:30107-30112

Internal links

Proteins Encoded

PeIA precursor

External links

Ncbi
GenBank	DQ008450

Tools

Please cite:
Kaas Q, Yu R, Jin AH, Dutertre S and Craik DJ. ConoServer: updated content, knowledge, and discovery tools in the conopeptide database. Nucleic Acids Research (2012) 40(Database issue):D325-30
Kaas Q, Westermann JC, Halai R, Wang CK and Craik DJ. ConoServer, a database for conopeptide sequences and structures. Bioinformatics (2008) 24(3):445-6

ConoServer is managed at the Institute of Molecular Bioscience IMB, Brisbane, Australia.

The database and computational tools found on this website may be used for academic research only, provided that it is referred to ConoServer, the database of conotoxins (http://www.conoserver.org) and the above reference is cited. For any other use please contact David Craik (d.craik@imb.uq.edu.au).

Contacts:
David Craik
Quentin Kaas

Last updated: Wednesday 29 March 2023